3xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2 probasin_mTQ2_FlpO
(Plasmid #68405)

• Purpose: The prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex8 and SMAD4 ex2. are expressed by the U6 promoter
• Depositing Lab: Jannik Elverløv-Jakobsen
• Publication: Cas9/CRISPR pig transposon plasmid_LIR_TRE_CAG_mKateII-Puro-STOP_mVenus-Cas9-PA-RIR (unpublished)

Backbone

• Vector backbone: Amp
• Backbone size w/o insert (bp): 2500
• Total vector size (bp): 7648
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: 3xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2
• Alt name: gRNAs target PTEN exon 5, p53 exon 8, SMAD4 exon 2
• Species: Synthetic
• Insert Size (bp): 1059
• Promoter: U6

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NruI (unknown if destroyed)
• 3′ cloning site: KpnI (unknown if destroyed)
• 5′ sequencing primer: ttttggcaagtcagttaggaca
• 3′ sequencing primer: GGAATGGTAGATGTTTAAAC

Gene/Insert 2

• Gene/Insert name: FlpO
• Species: Synthetic
• Insert Size (bp): 1300
• Promoter: Synthetic Probasin ARRx2
• Tag / Fusion Protein:
  • mTurquoise2 (BFP) (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (unknown if destroyed)
• 3′ cloning site: PacI (unknown if destroyed)
• 5′ sequencing primer: GGAATGGTAGATGTTTAAAC
• 3′ sequencing primer: aagtcgtgctgcttcatgtg

Resource Information

• Supplemental Documents:
  • Probasin_med PTENA og P53B gRNA_SMAD4_A ARRx2 (erstatter pdx) mTQ2_FlpO

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry