SepOTSκ
(Plasmid #68291)

• Purpose: Phosphoserine orthogonal translation system
• Depositing Lab: Jesse Rinehart
• Publication: Pirman et al Nat Commun. 2015 Sep 9;6:8130. doi: 10.1038/ncomms9130.

Backbone

• Vector backbone: pKD
• Modifications to backbone: pKD is derived from pKK223-3 (Pharmacia). This plasmid encodes a variant of the phosphoserine orthogonal translation system. Another plasmid encoding a protein of interest with TAG at the proper position is needed for recombinant phosphoprotein expression. See article and supplementary information for cloning information.
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 25 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Growth instructions: This plasmid is slow growing and may take up to 24 hours to produce colonies.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: SepRS/EF-Sep, 4xtRNA-Sep-A37
• Species: Synthetic

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

See supplementary information accompanying article for additional cloning information. We recommend introducing this plasmid into a recoded strain of E. coli (no genomic TAG codons) for high-efficiency phoshoprotein expression.

For plasmid propagation use NEB Stable cells. Check tRNA locus with the following primer pair: TCATTACAGAAACGGCTTTT, CATCGCCGCTTCCACTTTTT

The correct size of expected PCR product is 1.4kb.