pTXB3 AurA
(Plasmid #68270)

• Purpose: bacterial expression of human AurA
• Depositing Lab: Stefano Ferrari
• Publication: Krystyniak et al Oncogene. 2006 Jan 19;25(3):338-48.

Backbone

• Vector backbone: pTXB1
• Backbone manufacturer: NEB
• Backbone size w/o insert (bp): 6700
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: AurA
• Alt name: aurora kinase A
• Alt name: AURKA
• Alt name: ARK1
• Species: H. sapiens (human)
• Mutation: See depositor comment below
• Entrez Gene: AURKA (a.k.a. AIK, ARK1, AURA, BTAK, PPP1R47, STK15, STK6, STK7)
• Promoter: T7
• Tag / Fusion Protein:
  • Mxe intein/chitin binding domain (C terminal on backbone)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: T7
• 3′ sequencing primer: MxeInt-R AGGGCAACTAGTGCATCTCC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Use BL21 cells for protein production.

AurA mutation V57I has been described as “common coding region polymorphism” (Egan K et al., 2004, Carcinogenesis 25:2149)