Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTXB1-EXO1b D173A
(Plasmid #68269)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 68269 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pTXB1
  • Backbone manufacturer
    NEB
  • Backbone size w/o insert (bp) 6700
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    EXO1
  • Alt name
    exonuclease 1
  • Species
    H. sapiens (human)
  • Mutation
    catalytically-dead D173A. Please see depositor comments below
  • Entrez Gene
    EXO1 (a.k.a. HEX1, hExoI)
  • Promoter T7
  • Tag / Fusion Protein
    • Mxe intein/chitin binding domain (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site SapI (not destroyed)
  • 5′ sequencing primer T7
  • 3′ sequencing primer MxeInt-R AGGGCAACTAGTGCATCTCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Use BL21 cells for protein production.

EXO1b K589 was point-mutated to E, since this is the sequence described at UniProt (entry Q9UQ84). EXO1b also contains the following natural variants that were not corrected:
H354>R
E670>G
R723>C

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTXB1-EXO1b D173A was a gift from Stefano Ferrari (Addgene plasmid # 68269 ; http://n2t.net/addgene:68269 ; RRID:Addgene_68269)
  • For your References section:

    DNA end resection by CtIP and exonuclease 1 prevents genomic instability. Eid W, Steger M, El-Shemerly M, Ferretti LP, Pena-Diaz J, Konig C, Valtorta E, Sartori AA, Ferrari S. EMBO Rep. 2010 Dec;11(12):962-8. doi: 10.1038/embor.2010.157. Epub 2010 Nov 5. 10.1038/embor.2010.157 PubMed 21052091