pTXB1-EXO1b
(Plasmid #68267)

• Purpose: Bacterial expression of human EXO1
• Depositing Lab: Stefano Ferrari
• Publication: El-Shemerly et al Cancer Res. 2005 May 1;65(9):3604-9.

Backbone

• Vector backbone: pTXB1
• Backbone manufacturer: NEB
• Backbone size w/o insert (bp): 6700
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: EXO1
• Alt name: exonuclease 1
• Species: H. sapiens (human)
• Mutation: b form, codons 1-846. Please see depositor comments below
• Entrez Gene: EXO1 (a.k.a. HEX1, hExoI)
• Promoter: T7
• Tag / Fusion Protein:
  • Mxe intein/chitin binding domain (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: SapI (not destroyed)
• 5′ sequencing primer: T7
• 3′ sequencing primer: MxeInt-R AGGGCAACTAGTGCATCTCC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Use BL21 cells for protein production.

EXO1b K589 was point-mutated to E, since this is the sequence described at UniProt (entry Q9UQ84). EXO1b also contains the following natural variants that were not corrected:
H354>R
E670>G
R723>C