pTXB1-EXO1b
(Plasmid
#68267)
-
PurposeBacterial expression of human EXO1
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 68267 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTXB1
-
Backbone manufacturerNEB
- Backbone size w/o insert (bp) 6700
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEXO1
-
Alt nameexonuclease 1
-
SpeciesH. sapiens (human)
-
Mutationb form, codons 1-846. Please see depositor comments below
-
Entrez GeneEXO1 (a.k.a. HEX1, hExoI)
- Promoter T7
-
Tag
/ Fusion Protein
- Mxe intein/chitin binding domain (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site SapI (not destroyed)
- 5′ sequencing primer T7
- 3′ sequencing primer MxeInt-R AGGGCAACTAGTGCATCTCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Use BL21 cells for protein production.
EXO1b K589 was point-mutated to E, since this is the sequence described at UniProt (entry Q9UQ84). EXO1b also contains the following natural variants that were not corrected:
H354>R
E670>G
R723>C
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTXB1-EXO1b was a gift from Stefano Ferrari (Addgene plasmid # 68267 ; http://n2t.net/addgene:68267 ; RRID:Addgene_68267) -
For your References section:
Degradation of human exonuclease 1b upon DNA synthesis inhibition. El-Shemerly M, Janscak P, Hess D, Jiricny J, Ferrari S. Cancer Res. 2005 May 1;65(9):3604-9. 10.1158/0008-5472.CAN-04-4069 PubMed 15867354