pSG5-FLAG-mEKLF
(Plasmid #67833)

• Purpose: Expression of FL-EKLF driven by SV40 promoter
• Depositing Lab: James Bieker
• Publication: Soni et al Proc Natl Acad Sci U S A. 2014 Sep 16;111(37):13337-42. doi: 10.1073/pnas.1405422111. Epub 2014 Sep 2.

Backbone

• Vector backbone: pSG5
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 4076
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: EKLF
• Species: M. musculus (mouse)
• Mutation: Full-length mEKLF is aa 20-376; amino acid 19 is the initiator Methionine; See depositor comments below on mutations G299S, T305S
• Entrez Gene: Klf1 (a.k.a. Eklf, Nan)
• Promoter: SV40
• Tag / Fusion Protein:
  • FLAG (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: StuI (unknown if destroyed)
• 3′ cloning site: BamHI (unknown if destroyed)
• 5′ sequencing primer: SV40pro-F2 (CCCCATGGCTGACTAATTTTT)
• 3′ sequencing primer: SV40 poly A Reverse

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Entire EKLF open reading frame is defined as nucleotides 71-1215 and described in PMID 7682653. Mutations G299S and T305S have no functional consequences.