Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMT3-FLAG-KLF3
(Plasmid #49102)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 49102 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMT3
  • Backbone size w/o insert (bp) 5100
  • Total vector size (bp) 1035
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Krüppel-Like Factor 3(KLF3)
  • Alt name
    BKLF
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1035
  • GenBank ID
    NC_000071.6
  • Tag / Fusion Protein
    • FLAG (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GACAATGACATCCACTTTGC
  • 3′ sequencing primer CGTCAAGTTTGGCGCGAAAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMT3-FLAG-KLF3 was a gift from Merlin Crossley (Addgene plasmid # 49102 ; http://n2t.net/addgene:49102 ; RRID:Addgene_49102)
  • For your References section:

    KLF3 regulates muscle-specific gene expression and synergizes with serum response factor on KLF binding sites. Himeda CL, Ranish JA, Pearson RC, Crossley M, Hauschka SD. Mol Cell Biol. 2010 Jul;30(14):3430-43. doi: 10.1128/MCB.00302-10. Epub 2010 Apr 19. 10.1128/MCB.00302-10 PubMed 20404088