PNCA-GFP
(Plasmid
#67789)
-
PurposeUse together with pCMV-intron and VSV-G to package MMLV reporter virus
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 67789 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepNCA
-
Backbone manufacturerAddgene Plasmid 17363
- Backbone size w/o insert (bp) 8000
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMMLV-LTR-GFP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer Amp-R (ATAATACCGCGCCACATAGC) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PNCA-GFP was a gift from Stephen Goff (Addgene plasmid # 67789 ; http://n2t.net/addgene:67789 ; RRID:Addgene_67789) -
For your References section:
Dynamic instability of genomic methylation patterns in pluripotent stem cells. Ooi SK, Wolf D, Hartung O, Agarwal S, Daley GQ, Goff SP, Bestor TH. Epigenetics Chromatin. 2010 Sep 24;3(1):17. doi: 10.1186/1756-8935-3-17. 10.1186/1756-8935-3-17 PubMed 20868487