PNCA-luciferase
(Plasmid
#67793)
-
PurposeUse together with pCMV-intron and VSV-G to package MMLV reporter virus
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 67793 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepNCA
- Backbone size w/o insert (bp) 8000
-
Modifications to backboneGFP cassette in pNCA-GFP was replaced with the firefly luciferase gene via BamHI/XhoI restriction sites.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMMLV-LTR-firefly luciferase
-
SpeciesMoloney murine leukemia virus
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer Amp-R (ATAATACCGCGCCACATAGC) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PNCA-luciferase was a gift from Stephen Goff (Addgene plasmid # 67793 ; http://n2t.net/addgene:67793 ; RRID:Addgene_67793) -
For your References section:
Postentry restriction of Mason-Pfizer monkey virus in mouse cells. Wang GZ, Goff SP. J Virol. 2015 Mar;89(5):2813-9. doi: 10.1128/JVI.03051-14. Epub 2014 Dec 24. 10.1128/JVI.03051-14 PubMed 25540373