pAAV Syn hBE Rh Guanylyl Cyclase1 2A tDimer
(Plasmid #66779)

• Purpose: The rhodopsin-guanylyl cyclase of the aquatic fungus Blastocladiella emersonii enables fast optical control of cGMP signaling
• Depositing Lab: Thomas Oertner
• Publication: Scheib et al Sci Signal. 2015 Aug 11;8(389):rs8. doi: 10.1126/scisignal.aab0611.

Backbone

• Vector backbone: pAAV
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 4562
• Total vector size (bp): 7964
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: hbeRhGC
• Alt name: humanized Rhodopsin Guanylyl Cyclase 1
• Alt name: fungal rhodopsin guanylyl cyclase
• Species: Blastocladiella emersonii
• Insert Size (bp): 1878
• GenBank ID: KP731361 KF309499
• Promoter: human Synapsin

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: GACTCAGCGCTGCCTCAGTCTG;CTGCGGAGTAGAAAAAGC;GCCAGAAACCCAGAGAAGA;GCGGCCTGAGGTGGATTCG;GACGCTTATCTGGGAGTG
• 3′ sequencing primer: CGCTCCCACTTGAAGCCCTC

Gene/Insert 2

• Gene/Insert name: red fluorescent protein
• Alt name: tDimer 2
• Species: Discoma sp.
• Insert Size (bp): 1395
• Promoter: human Synapsin

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: ggcagaggaagtcttctaacat
• 3′ sequencing primer: gtaatccagaggttgattatcg

Resource Information

• A portion of this plasmid was derived from a plasmid made by: hBE Rh GC originally from P.Hegemann-HU-Berlin Germany tDimer originally from R.Tsien USD USA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry