pLV hMyoD-IRES-dsRed
(Plasmid
#66631)
-
PurposeCo-expresses human MyoD and dsRed
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 66631 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backboneFUGW
- Total vector size (bp) 11500
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman MyoD IRES dsRed
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2200
-
Entrez GeneMYOD1 (a.k.a. CMYP17, MYF3, MYOD, MYODRIF, PUM, bHLHc1)
- Promoter hUbc
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SfiI (not destroyed)
- 3′ cloning site SfiI (not destroyed)
- 5′ sequencing primer gttggcgagtgtgttttgtg
- 3′ sequencing primer CAAACGCACACCGGCCTTAT (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV hMyoD-IRES-dsRed was a gift from Charles Gersbach (Addgene plasmid # 66631 ; http://n2t.net/addgene:66631 ; RRID:Addgene_66631)
Map uploaded by the depositor.
