-
Purposeexpression of scrambled shRNA
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 46896 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLKO.1
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namescrambled
-
gRNA/shRNA sequenceaacgtacgcggaatacttcga
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer LKO.1 5' (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO-sh-hSC was a gift from Do-Hyung Kim (Addgene plasmid # 46896 ; http://n2t.net/addgene:46896 ; RRID:Addgene_46896) -
For your References section:
SH3BP4 is a negative regulator of amino acid-Rag GTPase-mTORC1 signaling. Kim YM, Stone M, Hwang TH, Kim YG, Dunlevy JR, Griffin TJ, Kim DH. Mol Cell. 2012 Jun 29;46(6):833-46. doi: 10.1016/j.molcel.2012.04.007. Epub 2012 May 9. 10.1016/j.molcel.2012.04.007 PubMed 22575674