Prig-3::CD4::spGFP11
(Plasmid #65830)

• Purpose: For membrane contact
• Depositing Labs: Cori Bargmann, Kang Shen
• Publication: Feinberg et al Neuron. 2008 Feb 7. 57(3):353-63.

Backbone

• Vector backbone: pSM
• Backbone manufacturer: C.I. Bargmann and S. MaCarroll
• Backbone size w/o insert (bp): 3500
• Total vector size (bp): 7444
• Vector type: Worm Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Homo sapiens CD4 molecule (CD4), transcript variant 2, mRNA
• Alt name: CD4-2 cDNA with artificial introns
• Species: H. sapiens (human)
• Insert Size (bp): 1101
• GenBank ID: NM_001195014
• Entrez Gene: CD4 (a.k.a. CD4mut, IMD79, Leu-3, OKT4D, T4)
• Promoter: Prig-3
• Tag / Fusion Protein:
  • spGFP11 (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XmaI (not destroyed)
• 3′ cloning site: SacI (not destroyed)
• 5′ sequencing primer: GCCAAAGGACCCAAAGGTATG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Evan H Feinberg from Bargmann lab made it originally.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry