pJB005
(Plasmid
#65468)
-
PurposepTrc plasmid expressing GFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 65468 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTrcHisB
-
Backbone manufacturerLife Technologies
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP
-
Alt nameGreen Fluorescent Protein
-
Insert Size (bp)756
- Promoter trc
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TGTGGGCACTCGACCGGAATTATC
- 3′ sequencing primer GGCGACACGGAAATGTTGAATAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJB005 was a gift from Keith Tyo (Addgene plasmid # 65468 ; http://n2t.net/addgene:65468 ; RRID:Addgene_65468) -
For your References section:
N-Terminal-Based Targeted, Inducible Protein Degradation in Escherichia coli. Sekar K, Gentile AM, Bostick JW, Tyo KE. PLoS One. 2016 Feb 22;11(2):e0149746. doi: 10.1371/journal.pone.0149746. eCollection 2016. PONE-D-15-42990 [pii] PubMed 26900850