pKS014
(Plasmid
#65467)
-
PurposepSC101 based plasmid where pl-tetO expression drives synthesis of construct expressing (N to C terminal) Ntag and beta-galactosidase
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 65467 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSC101
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameNtag-beta galactosidase
-
Insert Size (bp)3400
- Promoter pl-TetO
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGCGTATCACGAGGCCCTTTC
- 3′ sequencing primer GGATAACAGAAAGGCCGGGAAATAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKS014 was a gift from Keith Tyo (Addgene plasmid # 65467 ; http://n2t.net/addgene:65467 ; RRID:Addgene_65467) -
For your References section:
N-Terminal-Based Targeted, Inducible Protein Degradation in Escherichia coli. Sekar K, Gentile AM, Bostick JW, Tyo KE. PLoS One. 2016 Feb 22;11(2):e0149746. doi: 10.1371/journal.pone.0149746. eCollection 2016. PONE-D-15-42990 [pii] PubMed 26900850