Skip to main content
Addgene

FUW-ubiquitin-ephrinB1-SV40-RFP (b1R)
(Plasmid #65446)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 65446 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    FUW
  • Backbone manufacturer
    Addgene Plasmid 14882
  • Total vector size (bp) 10334
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ephrin B1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1037
  • Entrez Gene
    Efnb1 (a.k.a. Cek5-L, EFL-3, Elk-L, Epl2, Eplg2, LERK-2, Lerk2, Stra1)
  • Promoter UBQ
  • Tag / Fusion Protein
    • SV40-RFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PacI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer hUBCpro-F
  • 3′ sequencing primer mRFP1-R GGAGCCGTACTGGAACTGAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

PacI-AscI fragment will excise the entire ubiquitin promoter-ephrinB1-SV40-RFP cassette. Bam-AgeI site used to clone ephrin B1 were destroyed.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FUW-ubiquitin-ephrinB1-SV40-RFP (b1R) was a gift from Eduard Batlle (Addgene plasmid # 65446 ; http://n2t.net/addgene:65446 ; RRID:Addgene_65446)
  • For your References section:

    EphB-ephrin-B interactions suppress colorectal cancer progression by compartmentalizing tumor cells. Cortina C, Palomo-Ponce S, Iglesias M, Fernandez-Masip JL, Vivancos A, Whissell G, Huma M, Peiro N, Gallego L, Jonkheer S, Davy A, Lloreta J, Sancho E, Batlle E. Nat Genet. 2007 Nov;39(11):1376-83. Epub 2007 Sep 30. 10.1038/ng.2007.11 PubMed 17906625