FUW-ubiquitin-ephrinB1-SV40-RFP (b1R)
(Plasmid #65446)

• Purpose: Expression of ephrinB1 and RFP in mammalian cells
• Depositing Lab: Eduard Batlle
• Publication: Cortina et al Nat Genet. 2007 Nov;39(11):1376-83. Epub 2007 Sep 30.

Backbone

• Vector backbone: FUW
• Backbone manufacturer: Addgene Plasmid 14882
• Total vector size (bp): 10334
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ephrin B1
• Species: M. musculus (mouse)
• Insert Size (bp): 1037
• Entrez Gene: Efnb1 (a.k.a. Cek5-L, EFL-3, Elk-L, Epl2, Eplg2, LERK-2, Lerk2, Stra1)
• Promoter: UBQ
• Tag / Fusion Protein:
  • SV40-RFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: PacI (not destroyed)
• 3′ cloning site: AscI (not destroyed)
• 5′ sequencing primer: hUBCpro-F
• 3′ sequencing primer: mRFP1-R GGAGCCGTACTGGAACTGAG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

PacI-AscI fragment will excise the entire ubiquitin promoter-ephrinB1-SV40-RFP cassette. Bam-AgeI site used to clone ephrin B1 were destroyed.