pLXSN-EGFR
(Plasmid
#65226)
-
PurposeExpression of EGFR in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 65226 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLXSN
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 5900
- Total vector size (bp) 9900
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameEGFR
-
Alt nameHER1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4000
-
GenBank IDNM_005228
-
Entrez GeneEGFR (a.k.a. ERBB, ERBB1, ERRP, HER1, NISBD2, PIG61, mENA)
- Promoter LTR
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HpaI (destroyed during cloning)
- 3′ cloning site HpaI (destroyed during cloning)
- 5′ sequencing primer CTCTCCCCCTTGAACCTC
- 3′ sequencing primer GACTTTCCACACCCTAACTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLXSN-EGFR was a gift from Axel Ullrich (Addgene plasmid # 65226 ; http://n2t.net/addgene:65226 ; RRID:Addgene_65226) -
For your References section:
Transforming potentials of epidermal growth factor and nerve growth factor receptors inversely correlate with their phospholipase C gamma affinity and signal activation. Obermeier A, Tinhofer I, Grunicke HH, Ullrich A. EMBO J. 1996 Jan 2;15(1):73-82. PubMed 8598208