Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRK5RS-HERCD533
(Plasmid #65224)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 65224 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRK5
  • Backbone manufacturer
    BD PharMingen
  • Backbone size w/o insert (bp) 4754
  • Total vector size (bp) 8654
  • Modifications to backbone
    modified MCS
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    HERCD533
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3900
  • Mutation
    deleted AA 654-1186
  • GenBank ID
    NM_005228
  • Entrez Gene
    EGFR (a.k.a. ERBB, ERBB1, ERRP, HER1, NISBD2, PIG61, mENA)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CATACGATTTAGGTGACACTATAG
  • 3′ sequencing primer TATAAGCTGCAATAAAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Insert codes for AA 1-653 (extracellular and transmembrane domains) Note: Amino acid number may be off when compared to current NCBI entry. Please check QC sequence to verify end of coding region.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRK5RS-HERCD533 was a gift from Axel Ullrich (Addgene plasmid # 65224 ; http://n2t.net/addgene:65224 ; RRID:Addgene_65224)
  • For your References section:

    Anti-oncogenic activity of signalling-defective epidermal growth factor receptor mutants. Redemann N, Holzmann B, von Ruden T, Wagner EF, Schlessinger J, Ullrich A. Mol Cell Biol. 1992 Feb;12(2):491-8. PubMed 1346334