pRK5RS-HERCD533
(Plasmid #65224)

• Purpose: Expression of dominant negative EGFR in mammalian cells
• Depositing Lab: Axel Ullrich
• Publication: Redemann et al Mol Cell Biol. 1992 Feb;12(2):491-8.

Backbone

• Vector backbone: pRK5
• Backbone manufacturer: BD PharMingen
• Backbone size w/o insert (bp): 4754
• Total vector size (bp): 8654
• Modifications to backbone: modified MCS
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: HERCD533
• Species: H. sapiens (human)
• Insert Size (bp): 3900
• Mutation: deleted AA 654-1186
• GenBank ID: NM_005228
• Entrez Gene: EGFR (a.k.a. ERBB, ERBB1, ERRP, HER1, NISBD2, NNCIS, PIG61, mENA)
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: CATACGATTTAGGTGACACTATAG
• 3′ sequencing primer: TATAAGCTGCAATAAAC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Insert codes for AA 1-653 (extracellular and transmembrane domains) Note: Amino acid number may be off when compared to current NCBI entry. Please check QC sequence to verify end of coding region.