pAAV-Syn-ArchT-GFP
(Plasmid #63141)

• Purpose: AAV-mediated expression of ArchT-GFP under the Syn promoter. Using hGHpA signal.
• Depositing Lab: Edward Boyden
• Publication: Han et al Front Syst Neurosci. 2011;5:18. Epub 2011 Apr 13.

Backbone

• Vector backbone: AAV
• Backbone manufacturer: original from Stratagene
• Backbone size w/o insert (bp): 4707
• Total vector size (bp): 6183
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: DH5alpha at 37°C or Stbl3 at 30°C. Carbenicillin is preferred over ampicillin. In DH5alpha this plasmid may act more like a high copy plasmid, although in Stbl3 it may act more like a low copy plasmid.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ArchT-GFP
• Alt name: archaerhodopsin TP009-GFP
• Species: Halorubrum sp. TP009
• Insert Size (bp): 1476
• GenBank ID: HM367071.1
• Promoter: human synapsin promoter
• Tag / Fusion Protein:
  • GFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: gcacgggcgcgaccatctgc
• 3′ sequencing primer: TAGCGTAAAAGGAGCAACATAG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The plasmid is sequenced completely by the depositing lab except for parts of both ITRs. Multiple digestions were done to verify the vector structure. The construct and the virus were both tested in vitro.

For additional information on Arch, please see Chow et al., Nature. 2010 Jan 7. 463(7277):98-102. PubMed ID: 20054397