-
PurposeAAV-mediated expression of ChrimsonR-tdTomato under the Syn promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal. TdTomato is a codon diversified version.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 62723 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
AAV1 | 62723-AAV1 | Virus (100 µL at titer ≥ 7 × 10¹² vg/mL) and Plasmid. | $405 | ||
AAV5 | 62723-AAV5 | Virus (100 µL at titer ≥ 5×10¹² vg/mL) and Plasmid. | $405 |
Backbone
-
Vector backboneAAV-Syn-FLEX
-
Backbone manufactureroriginal from Stratagene
- Backbone size w/o insert (bp) 4684
- Total vector size (bp) 7180
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsDH5alpha at 37°C or Stbl3 at 30°C. Carbenicillin is preferred over ampicillin. In DH5alpha this plasmid may act more like a high copy plasmid, although in Stbl3 it may act more like a low copy plasmid.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameChrimsonR-tdTomato
-
Alt nameChrimson K176R mutant- tdTomato
-
Alt nameChR88m19-tdTomato
-
Alt nameChlamydomonas noctigama channelrhodopsin K176R mutant-tdTomato
-
SpeciesChlamydomonas noctigama
-
Insert Size (bp)2496
-
MutationChrimson K176R mutant
-
GenBank IDKF992060
- Promoter human synapsin promoter
-
Tag
/ Fusion Protein
- tdTomato (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer gcacgggcgcgaccatctgc
- 3′ sequencing primer TAGCGTAAAAGGAGCAACATAG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The plasmid is fully sequenced in the coding sequence regions (opsin-fluorophore and important flanking regions). Multiple digestions were done to verify the vector structure. The construct and the virus were both tested in vitro.
Information for AAV1 (Catalog # 62723-AAV1) ( Back to top)
Purpose
Ready-to-use AAV1 particles produced from pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] (#62723). In addition to the viral particles, you will also receive purified pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] plasmid DNA.
Cre-dependent expression of ChrimsonR-tdTomato under the control of the Synapsin promoter. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 7 × 10¹² vg/mL
- Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
- Buffer PBS + 0.001% Poloxamer 188 + 200 mM NaCl
- Serotype AAV1
- Purification Iodixanol gradient ultracentrifugation
- Reporter Gene tdTomato (Cre-dependent)
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Addgene Comments
Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.8% of viral particles in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, it is necessary to optimize the injection volume and viral titer to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral particle dosage in order to reduce the likelihood of Cre-independent expression.
Information for AAV5 (Catalog # 62723-AAV5) ( Back to top)
Purpose
Ready-to-use AAV5 particles produced from pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] (#62723). In addition to the viral particles, you will also receive purified pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] plasmid DNA.
Cre-dependent ChrimsonR-tdTomato under the control of the Synapsin promoter. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 5×10¹² vg/mL
- Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV5 cap gene
- Buffer PBS + 0.001% Poloxamer 188 + 200 mM NaCl
- Serotype AAV5
- Purification Iodixanol gradient ultracentrifugation
- Reporter Gene tdTomato (Cre-dependent)
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Addgene Comments
Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.8% of viral particles in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, it is necessary to optimize the injection volume and viral titer to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral particle dosage in order to reduce the likelihood of Cre-independent expression.
Data submitted about 62723-AAV5 by requesting scientist(s):
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] was a gift from Edward Boyden (Addgene plasmid # 62723 ; http://n2t.net/addgene:62723 ; RRID:Addgene_62723) For viral preps, please replace (Addgene plasmid # 62723) in the above sentence with: (Addgene viral prep # 62723-AAV1) or (Addgene viral prep # 62723-AAV5) -
For your References section:
Independent optical excitation of distinct neural populations. Klapoetke NC, Murata Y, Kim SS, Pulver SR, Birdsey-Benson A, Cho YK, Morimoto TK, Chuong AS, Carpenter EJ, Tian Z, Wang J, Xie Y, Yan Z, Zhang Y, Chow BY, Surek B, Melkonian M, Jayaraman V, Constantine-Paton M, Wong GK, Boyden ES. Nat Methods. 2014 Mar;11(3):338-46. doi: 10.1038/nmeth.2836. Epub 2014 Feb 9. 10.1038/nmeth.2836 PubMed 24509633