pAAV-CaMKII-Chrimson-GFP
(Plasmid #62718)

• Purpose: AAV-mediated expression of Chrimson-GFP under the CaMKII promoter. Using SV40pA signal.
• Depositing Lab: Edward Boyden
• Publication: Klapoetke et al Nat Methods. 2014 Mar;11(3):338-46. doi: 10.1038/nmeth.2836. Epub 2014 Feb 9.

Backbone

• Vector backbone: AAV-CaMKII
• Backbone manufacturer: Scott Sternson
• Backbone size w/o insert (bp): 5088
• Total vector size (bp): 6873
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: DH5alpha at 37°C or Stbl3 at 30°C. Carbenicillin is preferred over ampicillin. In DH5alpha this plasmid may act more like a high copy plasmid, although in Stbl3 it may act more like a low copy plasmid.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Chrimson-GFP
• Alt name: ChR88-GFP
• Alt name: Chlamydomonas noctigama channelrhodopsin-GFP
• Species: Chlamydomonas noctigama
• Insert Size (bp): 1785
• GenBank ID: KF992060
• Promoter: CaMKII
• Tag / Fusion Protein:
  • GFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CGGCTCTAGAGCCTCTGC
• 3′ sequencing primer: TAGCGTAAAAGGAGCAACATAG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The plasmid is fully sequenced in the coding sequence regions (opsin-fluorophore and important flanking regions). The published CaMKII promoter contains 10 basepair differences vs. the wild-type, and that persists here. Multiple digestions were done to verify the vector structure. The construct and the virus were both tested in vitro.