-
Purposebroad host range plasmid for IPTG-inducible expression of eGFP. Designed for imaging Pseudomonas aeruginosa activity in biofilms.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 62547 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMF54
-
Modifications to backbonepKK233-2 with oriT and stabilized for replication in P. aeruginosa and with lacIq.
-
Vector typeBacterial Expression ; broad host range plasmid
-
Selectable markersAmpicillin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeGFP
-
Alt nameGFP mut2
- Promoter pTrc
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (unknown if destroyed)
- 3′ cloning site XbaI (unknown if destroyed)
- 5′ sequencing primer CAATTTCACACAGGAAACAGA
- 3′ sequencing primer TCAGGCTGAAAATCTTCTCT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAB1 was a gift from Michael Franklin (Addgene plasmid # 62547 ; http://n2t.net/addgene:62547 ; RRID:Addgene_62547) -
For your References section:
Contributions of antibiotic penetration, oxygen limitation, and low metabolic activity to tolerance of Pseudomonas aeruginosa biofilms to ciprofloxacin and tobramycin. Walters MC 3rd, Roe F, Bugnicourt A, Franklin MJ, Stewart PS. Antimicrob Agents Chemother. 2003 Jan;47(1):317-23. PubMed 12499208