-
PurposeTargets CreERT2 to the mouse Nxph4 stop codon
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 62219 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBluescriptII SK+
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 2850
- Total vector size (bp) 19650
-
Vector typeMammalian Expression, Mouse Targeting, Cre/Lox
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 25 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)Stbl2
-
Growth instructionsGrow on 15 ug/ml Kanamaycin
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNxph4-2A-CreERT2
-
Alt nameneurexophilin 4
-
SpeciesM. musculus (mouse); Bacteriophage
-
Insert Size (bp)16800
- Promoter Mouse Nxph4
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TCTTCGCTATTACGCCAGCT
- 3′ sequencing primer AACAGCTATGACCATG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Nxph4-2A-CreERT2 Targeting Vector was a gift from Hongkui Zeng (Addgene plasmid # 62219 ; http://n2t.net/addgene:62219 ; RRID:Addgene_62219) -
For your References section:
Anatomical characterization of Cre driver mice for neural circuit mapping and manipulation. Harris JA, Hirokawa KE, Sorensen SA, Gu H, Mills M, Ng LL, Bohn P, Mortrud M, Ouellette B, Kidney J, Smith KA, Dang C, Sunkin S, Bernard A, Oh SW, Madisen L, Zeng H. Front Neural Circuits. 2014 Jul 10;8:76. doi: 10.3389/fncir.2014.00076. eCollection 2014. 10.3389/fncir.2014.00076 PubMed 25071457