Skip to main content
Addgene

Nxph4-2A-CreERT2 Targeting Vector
(Plasmid #62219)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 62219 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pBluescriptII SK+
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 2850
  • Total vector size (bp) 19650
  • Vector type
    Mammalian Expression, Mouse Targeting, Cre/Lox
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 25 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl2
  • Growth instructions
    Grow on 15 ug/ml Kanamaycin
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Nxph4-2A-CreERT2
  • Alt name
    neurexophilin 4
  • Species
    M. musculus (mouse); Bacteriophage
  • Insert Size (bp)
    16800
  • Entrez Gene
    Nxph4 (a.k.a. 1110036M10Rik, AI851051)
  • Promoter Mouse Nxph4

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TCTTCGCTATTACGCCAGCT
  • 3′ sequencing primer AACAGCTATGACCATG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Nxph4-2A-CreERT2 Targeting Vector was a gift from Hongkui Zeng (Addgene plasmid # 62219 ; http://n2t.net/addgene:62219 ; RRID:Addgene_62219)

  • For your References section:

    Anatomical characterization of Cre driver mice for neural circuit mapping and manipulation. Harris JA, Hirokawa KE, Sorensen SA, Gu H, Mills M, Ng LL, Bohn P, Mortrud M, Ouellette B, Kidney J, Smith KA, Dang C, Sunkin S, Bernard A, Oh SW, Madisen L, Zeng H. Front Neural Circuits. 2014 Jul 10;8:76. doi: 10.3389/fncir.2014.00076. eCollection 2014. 10.3389/fncir.2014.00076 PubMed 25071457
Related items:
Commonly requested with: