-
PurposeExpresses RNA-Guided, Nuclease-Inactive VP64:dCas9-BFP:VP64—VdC9BV—Fusion Protein to Enable Transactivation of Endogenous Genes
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 62195 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneTetO-FUW
- Total vector size (bp) 13824
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameVP64dCas9BFPVP64
-
Alt nameVdC9BV
-
SpeciesSynthetic
-
MutationD10A H840A (catalytically inactive) Cas9 (dCas9)
-
Tag
/ Fusion Protein
- Two VP64s tagged to dCas9 fused to BFP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site EcoRI (destroyed during cloning)
- 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The vector backbone was from Addgene plasmid 27152 (PI Marius Wernig)
The dCas9:BFP fusion part of the insert was cloned from Addgene plasmid 44247 (PI Stanley Qi)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TetO-FUW-VdC9BV was a gift from Kam Leong (Addgene plasmid # 62195 ; http://n2t.net/addgene:62195 ; RRID:Addgene_62195) -
For your References section:
A CRISPR/Cas9-Based System for Reprogramming Cell Lineage Specification. Chakraborty S, Ji H, Kabadi AM, Gersbach CA, Christoforou N, Leong KW. Stem Cell Reports. 2014 Dec 9;3(6):940-7. doi: 10.1016/j.stemcr.2014.09.013. Epub 2014 Oct 23. 10.1016/j.stemcr.2014.09.013 PubMed 25448066