Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

c3GIC9n
(Plasmid #62192)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 62192 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    col1a1 Flp-in targeting construct
  • Total vector size (bp) 10668
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Top10
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    humanized S. Pyogenes Cas9 (D10A)
  • Alt name
    SpCas9n
  • Alt name
    hSpCas9n
  • Alt name
    hCas9n
  • Species
    S. Pyogenes
  • Insert Size (bp)
    4164
  • Mutation
    D10A substitution (Cas9n)
  • Promoter TRE3G
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TCTGCGACTCTAGAGGATCA
  • 3′ sequencing primer CACCCTGAAAACTTTGCCCC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    hCas9n was cloned from PX335
  • Article Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    c3GIC9n was a gift from Lukas Dow (Addgene plasmid # 62192 ; http://n2t.net/addgene:62192 ; RRID:Addgene_62192)
  • For your References section:

    Inducible in vivo genome editing with CRISPR-Cas9. Dow LE, Fisher J, O'Rourke KP, Muley A, Kastenhuber ER, Livshits G, Tschaharganeh DF, Socci ND, Lowe SW. Nat Biotechnol. 2015 Apr;33(4):390-4. doi: 10.1038/nbt.3155. Epub 2015 Feb 18. 10.1038/nbt.3155 PubMed 25690852