c3GIC9n
(Plasmid #62192)

• Purpose: col1a1 targeting vector for inducible [TRE3G]-GFP-IRES-Cas9n (D10A variant) expression. Contains NsiI cloning site for U6-sgRNA cassettes
• Depositing Lab: Lukas Dow
• Publication: Dow et al Nat Biotechnol. 2015 Apr;33(4):390-4. doi: 10.1038/nbt.3155. Epub 2015 Feb 18.

Backbone

• Vector backbone: col1a1 Flp-in targeting construct
• Total vector size (bp): 10668
• Vector type: CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): Top10
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: humanized S. Pyogenes Cas9 (D10A)
• Alt name: SpCas9n
• Alt name: hSpCas9n
• Alt name: hCas9n
• Species: S. Pyogenes
• Insert Size (bp): 4164
• Mutation: D10A substitution (Cas9n)
• Promoter: TRE3G
• Tag / Fusion Protein:
  • HA (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (destroyed during cloning)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: TCTGCGACTCTAGAGGATCA
• 3′ sequencing primer: CACCCTGAAAACTTTGCCCC

Resource Information

• Supplemental Documents:
  • c3CIC9n
• A portion of this plasmid was derived from a plasmid made by: hCas9n was cloned from PX335
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry