Skip to main content
Addgene

MS2_GFP
(Plasmid #61764)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61764 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Lentiviral expression vector
  • Backbone size w/o insert (bp) 4781
  • Total vector size (bp) 7538
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    None

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MS2 coat protein fused to eGFP
  • Species
    MS2 virus
  • Insert Size (bp)
    1188
  • Promoter Ubc promoter
  • Tag / Fusion Protein
    • eGFP (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CCGGGCCCGCTCTAGATTGAAT
  • 3′ sequencing primer unknown
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MS2_GFP was a gift from Daniel Larson (Addgene plasmid # 61764 ; http://n2t.net/addgene:61764 ; RRID:Addgene_61764)
  • For your References section:

    Kinetic competition during the transcription cycle results in stochastic RNA processing. Coulon A, Ferguson ML, de Turris V, Palangat M, Chow CC, Larson DR. Elife. 2014 Oct 1;3. doi: 10.7554/eLife.03939. 10.7554/eLife.03939 PubMed 25271374