Skip to main content
Addgene

pINTO-NSA::hSNRNP70
(Plasmid #61726)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61726 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pINTO-N-SA
  • Vector type
    Mammalian Expression
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL10 Gold
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SNRP70
  • Species
    H. sapiens (human)
  • Mutation
    Two silent mutations to ensure restriction site compatibility
  • GenBank ID
    NM_003089.5
  • Entrez Gene
    SNRNP70 (a.k.a. RNPU1Z, RPU1, SNRP70, Snp1, U1-70K, U170K, U1AP, U1RNP)
  • Promoter T-REx (CMV + 2xTetO2)
  • Tag / Fusion Protein
    • mSA (monomeric streptavidin) (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CTC GTT TAG TGA ACC GTC AG
  • 3′ sequencing primer AGATGGCTGGCAACTAGAAG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pINTO-NSA::hSNRNP70 was a gift from Roberto Bonasio (Addgene plasmid # 61726 ; http://n2t.net/addgene:61726 ; RRID:Addgene_61726)

  • For your References section:

    In Vivo Proximity Labeling for the Detection of Protein-Protein and Protein-RNA Interactions. Beck DB, Narendra V, Drury WJ 3rd, Casey R, Jansen PW, Yuan ZF, Garcia BA, Vermeulen M, Bonasio R. J Proteome Res. 2014 Dec 5;13(12):6135-43. doi: 10.1021/pr500196b. Epub 2014 Oct 29. 10.1021/pr500196b PubMed 25311790
Related items:
Commonly requested with: