Skip to main content
Addgene

Snap25-LSL-2A-GFP targeting vector
(Plasmid #61575)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61575 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pBS SK2+
  • Backbone size w/o insert (bp) 2959
  • Total vector size (bp) 18606
  • Modifications to backbone
    MCS region was modified
  • Vector type
    Mouse Targeting, Cre/Lox
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl2
  • Growth instructions
    Grow in 15 microg/ml kanamycin
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Snap25-LSL-2A-GFP
  • Species
    M. musculus (mouse); Aequorea victoria
  • Insert Size (bp)
    15647

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TCTTCGCTATTACGCCAGCT
  • 3′ sequencing primer AACAGCTATGACCATG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Snap25-LSL-2A-GFP targeting vector was a gift from Hongkui Zeng (Addgene plasmid # 61575 ; http://n2t.net/addgene:61575 ; RRID:Addgene_61575)

  • For your References section:

    Transgenic mice for intersectional targeting of neural sensors and effectors with high specificity and performance. Madisen L, Garner AR, Shimaoka D, Chuong AS, Klapoetke NC, Li L, van der Bourg A, Niino Y, Egolf L, Monetti C, Gu H, Mills M, Cheng A, Tasic B, Nguyen TN, Sunkin SM, Benucci A, Nagy A, Miyawaki A, Helmchen F, Empson RM, Knopfel T, Boyden ES, Reid RC, Carandini M, Zeng H. Neuron. 2015 Mar 4;85(5):942-58. doi: 10.1016/j.neuron.2015.02.022. 10.1016/j.neuron.2015.02.022 PubMed 25741722
Related items:
Commonly requested with: