Slc17a7-IRES2-Cre targeting vector
(Plasmid #61574)

• Purpose: Target the Cre recombinase gene to the stop codon of the mouse Slc17a7 (VGlut1) gene
• Depositing Lab: Hongkui Zeng
• Publication: Madisen et al Neuron. 2015 Mar 4;85(5):942-58. doi: 10.1016/j.neuron.2015.02.022.

Backbone

• Vector backbone: minimal cloning vector
• Backbone size w/o insert (bp): 2657
• Total vector size (bp): 18244
• Modifications to backbone: MCS region was modified
• Vector type: Mouse Targeting, Cre/Lox
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): Stbl2
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Slc17a7-IRES2-Cre
• Species: M. musculus (mouse); P1 Bacteriophage
• Insert Size (bp): 15587

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: TCCGTCAGGATGGCCTTCTG
• 3′ sequencing primer: TTCACACCGCATAGGGTCAT

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The Zeng lab recommends amplifying this plasmid in 15 microg/ml kanamycin to reduce recombination. Addgene is not able to supply the plasmid under these selection conditions and the stab you receive will be under Amp selection. We recommend using the low conc. Kan selection and checking your plasmid prep for recombination.