RAB14 shRNA
(Plasmid
#61496)
-
Purposeto knockdown endogenous RAB14 expression levels
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 61496 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLKO.3G
-
Backbone manufacturerChristophe Benoist & Diane Mathis (Addgene plasmid # 14748)
- Backbone size w/o insert (bp) 8174
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRAB14
-
gRNA/shRNA sequenceTAACAGCCCTAAATCGCTCCT
-
SpeciesH. sapiens (human)
-
GenBank ID
-
Entrez GeneRAB14 (a.k.a. FBP, RAB-14)
- Promoter hU6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer LKO.1 5' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
RAB14 shRNA was a gift from Curt Civin (Addgene plasmid # 61496 ; http://n2t.net/addgene:61496 ; RRID:Addgene_61496) -
For your References section:
MIR144 and MIR451 regulate human erythropoiesis via RAB14. Kim M, Tan YS, Cheng WC, Kingsbury TJ, Heimfeld S, Civin CI. Br J Haematol. 2014 Oct 14. doi: 10.1111/bjh.13164. 10.1111/bjh.13164 PubMed 25312678