lenti MS2-P65-HSF1_Hygro
(Plasmid #61426)

• Purpose: lenti vector encoding the MS2-P65-HSF1 activator helper complex with a 2A Hygro resistance marker NOTE: A version of this plasmid with improved titer is available: Addgene plasmid #89308 lentiMPH v2
• Depositing Lab: Feng Zhang
• Publication: Konermann et al Nature. 2014 Dec 10. doi: 10.1038/nature14136.

Backbone

• Vector backbone: plenti
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: none
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: MS2-P65-HSF1_2A_Hygro
• Species: H. sapiens (human), Synthetic
• Mutation: N55K in MS2
• Entrez Gene: HSF1 (a.k.a. HSTF1)
• Promoter: EF1A

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsiWI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: GTT TGG ATC TTG GTT CAT TCT CAA GCC TCA G
• 3′ sequencing primer: cacatagcgtaaaaggagcaacatag

Resource Information

• Articles Citing this Plasmid:
  • 120 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

IMPORTANT NOTES:

SAM libraries ordered prior to 4/3/2017 were shipped with this plasmid included.

As of 4/3/2017, a version of this plasmid with improved titer is available: Addgene plasmids #89308 lentiMPH v2 ( http://addgene.org/89308 )

For additional information, protocols and an activator sgRNA design tool, visit the Zhang lab website:
http://sam.genome-engineering.org/

Information for Lentiviral Prep (Catalog # 61426-LV)

Item is discontinued.

Addgene no longer distributes this item. Contact for more information.

Virus (1mL at titer > 7x10⁵ TU/mL)

Purpose

Ready-to-use Lentiviral Prep particles produced from lenti MS2-P65-HSF1_Hygro (#61426). In addition to the viral particles, you will also receive purified lenti MS2-P65-HSF1_Hygro plasmid DNA.

Delivery

• Volume: 1mL
• Titer: ≥7x10⁵ TU/mL
• Pricing: $150 USD for preparation of 1mL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: psPAX2 (plasmid #12260)
• Envelope: pMD2.G (plasmid #12259)
• Buffer: OptiPro
• Selectable Marker: Hygromycin

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Titering Method:

• ddPCR assay: 293T cells were transduced with serial dilutions of 61426-LV, harvested several days later, and genomic DNA was isolated. Copies of RRE were measured and normalized to RPP30.

Notes:

• PCR confirmation of insert: PCR was carried out with primers targeting the hygromycin-resistance gene and pBluescript. The PCR product was visualized on an agarose gel for size confirmation.
  Forward Primer: Hygro-F GACGGCAATTTCGATGATG
  Reverse Primer: pBluescript-KS TCGAGGTCGACGGTATC

Visit our viral production page for more information.

Addgene Comments

While the typical yield for lentiviral vectors ranges from 10⁶-10⁷ TU/mL, titers for large or toxic inserts, such as for MS2-P65-HSF1, can be 10-fold to 100-fold lower. Scientists generating their own lentiviral particles from MS2-P65-HSF1 should expect similarly low titers.

Information for Concentrated Lentiviral Prep (Catalog # 61426-LVC)

Item is discontinued.

Addgene no longer distributes this item. Contact for more information.

Virus (50µL at titer ≥ 8×10⁶ TU/mL)

Purpose

Ready-to-use Concentrated Lentiviral Prep particles produced from lenti MS2-P65-HSF1_Hygro (#61426). In addition to the viral particles, you will also receive purified lenti MS2-P65-HSF1_Hygro plasmid DNA.

Concentrated lentiviral particles carrying MS2-P65-HSF1 and hygromycin resistance.

Delivery

• Volume: 50 µL
• Titer: ≥8×10⁶ TU/mL
• Pricing: $175 USD for preparation of 50 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: psPAX2 (plasmid #12260)
• Envelope: pMD2.G (plasmid #12259)
• Buffer: PBS
• Selectable Marker: Hygromycin
• Purification: Lentivirus was harvested from cell culture medium (DMEM + 10% FBS). Lentiviral particles were then collected by precipitation in polyethylene glycol (PEG) followed by centrifugation. Precipitated pellets containing viral particles were resuspended in PBS.

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Titering Method:

• ddPCR assay: 293T cells were transduced with serial dilutions of 61426-LVC, harvested several days later, and genomic DNA was isolated. Copies of RRE were measured and normalized to RPP30.

Notes:

• PCR confirmation of insert: PCR was carried out with primers targeting the hygromycin-resistance gene and pBluescript. The PCR product was visualized on an agarose gel for size confirmation.
  Forward Primer: Hygro-F GACGGCAATTTCGATGATG
  Reverse Primer: pBluescript-KS TCGAGGTCGACGGTATC
• Confirmation of protein expression: A549 cells were singly transduced with 61426-LVC or doubly transduced with 61425-LV and 61426-LVC at an MOI of 1, and treated with hygromycin or hygromycin and blasticidin, respectively. Polyclonal pools of hygromycin-resistant or hygromycin and blasticidin-resistance cells were expanded, collected, lysed and tested for p65 expression via immunoblotting. You can view the stable cell line expression data here or in the image section at the top of this page. Read our protocol for generating stable cell lines here.

Visit our viral production page for more information.

Addgene Comments

While the typical yield for lentiviral vectors ranges from 10⁶-10⁷ TU/mL, titers for large or toxic inserts, such as for MS2-P65-HSF1, can be 10-fold to 100-fold lower. Scientists generating their own lentiviral particles from MS2-P65-HSF1 should expect similarly low titers.