lenti dCAS-VP64_Blast
(Plasmid #61425)

• Purpose: 3rd generation lenti vector encoding dCAS9-VP64 with 2A Blast resistance marker (EF1a-NLS-dCas9(N863)-VP64-2A-Blast-WPRE)
• Depositing Lab: Feng Zhang
• Publication: Konermann et al Nature. 2014 Dec 10. doi: 10.1038/nature14136.

Backbone

• Vector backbone: plenti
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: none
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: dCAS9(D10A, N863A)-VP64_2A_Blast
• Species: Synthetic; S. pyogenes
• Mutation: D10A and N863A in Cas9
• Promoter: EF1A

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsiWI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: GTTTGGATCTTGGTTCATTCTCAAGCCTCAG
• 3′ sequencing primer: cacatagcgtaaaaggagcaacatag

Resource Information

• Articles Citing this Plasmid:
  • 172 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

IMPORTANT NOTE: If you intend to order the SAM library, this plasmid will come included with that order. Please do NOT order this plasmid if you are already planning to order the SAM library.

For additional information, protocols and an activator sgRNA design tool, visit our website:
http://sam.genome-engineering.org/

Information for Lentiviral Prep (Catalog # 61425-LV)

Purpose

Ready-to-use Lentiviral Prep particles produced from lenti dCAS-VP64_Blast (#61425). In addition to the viral particles, you will also receive purified lenti dCAS-VP64_Blast plasmid DNA.

Delivery

• Volume: 1 mL
• Titer: ≥7x10⁵ TU/mL
• Pricing: $150 USD for preparation of 1 mL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: psPAX2 (plasmid #12260)
• Envelope: pMD2.G (plasmid #12259)
• Buffer: OptiPro
• Selectable Marker: Blasticidin

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Titering Method:

• ddPCR assay: 293T cells were transduced with serial dilutions of 61425-LV, harvested several days later, and genomic DNA was isolated. Copies of RRE were measured and normalized to RPP30.

Notes:

• PCR confirmation of insert: PCR was carried out with primers targeting Cas9 and the blasticidin-resistance gene. The PCR product was visualized on an agarose gel for size confirmation.
  Forward Primer: dCas9-F2 CCAAAGAGGTGCTGGACG
  Reverse Primer: Blast-R GCTCTTTCAATGAGGGTGGA

Visit our viral production page for more information.

Addgene Comments

While the typical yield for lentiviral vectors ranges from 10⁶-10⁷ TU/mL, titers for large or toxic inserts, such as for Cas9, can be 10-fold to 100-fold lower. Scientists generating their own lentiviral particles from Cas9 should expect similarly low titers.

To demonstrate that Addgene’s virus is fully functional, Addgene has generated stable cell lines from the Cas9-expressing lentiviruses. You can view the stable cell line expression data here or in the image section at the top of this page. Read our protocol for generating stable cell lines here.

Information for Concentrated Lentiviral Prep (Catalog # 61425-LVC)

Item is discontinued.

Addgene no longer distributes this item. Contact for more information.

Virus (50µL at titer > 1×10⁷ TU/mL)

Purpose

Ready-to-use Concentrated Lentiviral Prep particles produced from lenti dCAS-VP64_Blast (#61425). In addition to the viral particles, you will also receive purified lenti dCAS-VP64_Blast plasmid DNA.

Delivery

• Volume: 50 µL
• Titer: ≥1×10⁷ TU/mL
• Pricing: $175 USD for preparation of 50 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: psPAX2 (plasmid #12260)
• Envelope: pMD2.G (plasmid #12259)
• Buffer: PBS
• Selectable Marker: Blasticidin
• Purification: Lentivirus was harvested from cell culture medium (DMEM + 10% FBS). Lentiviral particles were then collected by precipitation in polyethylene glycol (PEG) followed by centrifugation. Precipitated pellets containing viral particles were resuspended in PBS.

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Titering Method:

• ddPCR assay: 293T cells were transduced with serial dilutions of 61425-LVC, harvested several days later, and genomic DNA was isolated. Copies of RRE were measured and normalized to RPP30.

Notes:

• PCR confirmation of insert: PCR was carried out with primers targeting dCas9 and the blasticidin-resistance gene. The PCR product was visualized on an agarose gel for size confirmation.
  Forward Primer: dCas9-F2 CCAAAGAGGTGCTGGACG
  Reverse Primer: Blast-R GCTCTTTCAATGAGGGTGGA

Visit our viral production page for more information.