MS2-P65-HSF1_GFP
(Plasmid #61423)

• Purpose: Expresses the MS2-P65-HSF1 activator helper complex with a 2A GFP. 3rd generation lentiviral vector.
• Depositing Lab: Feng Zhang
• Publication: Konermann et al Nature. 2014 Dec 10. doi: 10.1038/nature14136.

Backbone

• Vector backbone: lenti(AMP)
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Zeo marker is outside the LTRs and will not be packaged into virus.

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: none
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: MS2(N55K)-P65-HSF1_2A_GFP
• Species: H. sapiens (human), Synthetic
• Mutation: N55K in MS2
• Entrez Gene: HSF1 (a.k.a. HSTF1)
• Promoter: EF1A

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsiWI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: GTT TGG ATC TTG GTT CAT TCT CAA GCC TCA G
• 3′ sequencing primer: cacatagcgtaaaaggagcaacatag

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest
• Articles Citing this Plasmid:
  • 42 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For additional information, protocols and an activator sgRNA design tool, visit our website:
http://sam.genome-engineering.org/