dCAS9-VP64_GFP
(Plasmid #61422)

• Purpose: Expresses dCAS9-VP64 activator with 2A GFP
• Depositing Lab: Feng Zhang
• Publication: Konermann et al Nature. 2014 Dec 10. doi: 10.1038/nature14136.

Backbone

• Vector backbone: lenti(AMP)
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: GFP

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: none
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: dCAS9(D10A,H840A)-VP64_2A_GFP
• Species: Synthetic; S. pyogenes
• Mutation: D10A and H840A in Cas9
• Promoter: EF1A

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsiWI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: GTT TGG ATC TTG GTT CAT TCT CAA GCC TCA G
• 3′ sequencing primer: cacatagcgtaaaaggagcaacatag

Resource Information

• Articles Citing this Plasmid:
  • 54 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For additional information, protocols and an activator sgRNA design tool, visit our website:
http://sam.genome-engineering.org/

Information for Concentrated Lentiviral Prep (Catalog # 61422-LVC)

Purpose

Ready-to-use Concentrated Lentiviral Prep particles produced from dCAS9-VP64_GFP (#61422). In addition to the viral particles, you will also receive purified dCAS9-VP64_GFP plasmid DNA.

Delivery

• Volume: 50 µL
• Titer: ≥2.5×10⁶ TU/mL
• Pricing: $175 USD for preparation of 50 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: psPAX2 (plasmid #12260)
• Envelope: pMD2.G (plasmid #12259)
• Buffer: PBS
• Selectable Marker: GFP
• Purification: Lentivirus was harvested from cell culture medium (DMEM + 10% FBS). Lentiviral particles were then collected by precipitation in polyethylene glycol (PEG) followed by centrifugation. Precipitated pellets containing viral particles were resuspended in PBS.

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Titering Method:

• ddPCR assay: 293T cells were transduced with serial dilutions of 61422-LV, harvested several days later, and genomic DNA was isolated. Copies of RRE were measured and normalized to RPP30.

Notes:

• PCR confirmation of insert: PCR was carried out with primers targeting dCas9 and the WPRE element. The PCR product was visualized on an agarose gel for size confirmation.
  Forward Primer: dCas9-F2 CCAAAGAGGTGCTGGACG
  Reverse Primer: WPRE-R CATAGCGTAAAAGGAGCAACA

Visit our viral production page for more information.