Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

LSL-Cas9-Rosa26TV
(Plasmid #61408)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61408 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Ai9
  • Backbone size w/o insert (bp) 14500
  • Total vector size (bp) 20541
  • Vector type
    Mammalian Expression, Mouse Targeting, Cre/Lox, CRISPR
  • Selectable markers
    Neomycin (select with G418) ; DTA

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Please note that this plasmid is prone to recombination. We recommend screening 3-5 colonies to ensure the full plasmid is intact.
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    Cas9
  • Species
    Synthetic; streptococcus pyogenes
  • Insert Size (bp)
    4101
  • Mutation
    human codon optimized
  • Promoter CAG
  • Tags / Fusion Proteins
    • 3xFLAG (N terminal on insert)
    • P2A (C terminal on backbone)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer atgtctggatccccatcaagc
  • 3′ sequencing primer CTGCTTGTCGGCCATGATATAG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    EGFP
  • Insert Size (bp)
    714
  • Promoter CAG

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TGTCTCAGCTGGGAGGCGAC
  • 3′ sequencing primer gtatccacatagcgtaaaaggagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LSL-Cas9-Rosa26TV was a gift from Feng Zhang (Addgene plasmid # 61408 ; http://n2t.net/addgene:61408 ; RRID:Addgene_61408)
  • For your References section:

    CRISPR-Cas9 Knockin Mice for Genome Editing and Cancer Modeling. Platt RJ, Chen S, Zhou Y, Yim MJ, Swiech L, Kempton HR, Dahlman JE, Parnas O, Eisenhaure TM, Jovanovic M, Graham DB, Jhunjhunwala S, Heidenreich M, Xavier RJ, Langer R, Anderson DG, Hacohen N, Regev A, Feng G, Sharp PA, Zhang F. Cell. 2014 Sep 24. pii: S0092-8674(14)01163-5. doi: 10.1016/j.cell.2014.09.014. 10.1016/j.cell.2014.09.014 PubMed 25263330