Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

AAV-hSyn-REX-GECO0.9
(Plasmid #61249)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61249 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 4560
  • Total vector size (bp) 5814
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    REX-GECO0.9
  • Alt name
    Red excitation ratiometric genetically encoded Ca2+-indicators for optical version 0.9
  • Species
    Synthetic
  • Insert Size (bp)
    1254
  • Mutation
    Substitutions relative to R-GECO1: P60R, V61W, R66W, E77V, K80E, K97R, E138V, S142P, D147V, P220L, N257I, N267D, A302P, M339L, T382S
  • GenBank ID
    KP091744
  • Promoter hSyn

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH1 (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer GAGGAGTCGTGTCGTGCC
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The construct is numbered based on GCaMP.

There are 2 mismatches between Addgene's sequence and the provided reference sequence. These should not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-hSyn-REX-GECO0.9 was a gift from Robert Campbell (Addgene plasmid # 61249 ; http://n2t.net/addgene:61249 ; RRID:Addgene_61249)
  • For your References section:

    A long Stokes shift red fluorescent Ca(2+) indicator protein for two-photon and ratiometric imaging. Wu J, Abdelfattah AS, Miraucourt LS, Kutsarova E, Ruangkittisakul A, Zhou H, Ballanyi K, Wicks G, Drobizhev M, Rebane A, Ruthazer ES, Campbell RE. Nat Commun. 2014 Oct 31;5:5262. doi: 10.1038/ncomms6262. 10.1038/ncomms6262 PubMed 25358432