AAV-hSyn-REX-GECO0.9
(Plasmid #61249)

• Purpose: Expresses REX-GECO0.9 in neurons
• Depositing Lab: Robert Campbell
• Publication: Wu et al Nat Commun. 2014 Oct 31;5:5262. doi: 10.1038/ncomms6262.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 4560
• Total vector size (bp): 5814
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: REX-GECO0.9
• Alt name: Red excitation ratiometric genetically encoded Ca2+-indicators for optical version 0.9
• Species: Synthetic
• Insert Size (bp): 1254
• Mutation: Substitutions relative to R-GECO1: P60R, V61W, R66W, E77V, K80E, K97R, E138V, S142P, D147V, P220L, N257I, N267D, A302P, M339L, T382S
• GenBank ID: KP091744
• Promoter: hSyn

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamH1 (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: GAGGAGTCGTGTCGTGCC
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The construct is numbered based on GCaMP.

There are 2 mismatches between Addgene's sequence and the provided reference sequence. These should not affect plasmid function.