Skip to main content
Addgene

AAV-hSyn-REX-GECO0.9
(Plasmid #61249)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61249 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 4560
  • Total vector size (bp) 5814
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    REX-GECO0.9
  • Alt name
    Red excitation ratiometric genetically encoded Ca2+-indicators for optical version 0.9
  • Species
    Synthetic
  • Insert Size (bp)
    1254
  • Mutation
    Substitutions relative to R-GECO1: P60R, V61W, R66W, E77V, K80E, K97R, E138V, S142P, D147V, P220L, N257I, N267D, A302P, M339L, T382S
  • GenBank ID
    KP091744
  • Promoter hSyn

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH1 (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer GAGGAGTCGTGTCGTGCC
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The construct is numbered based on GCaMP.

There are 2 mismatches between Addgene's sequence and the provided reference sequence. These should not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-hSyn-REX-GECO0.9 was a gift from Robert Campbell (Addgene plasmid # 61249 ; http://n2t.net/addgene:61249 ; RRID:Addgene_61249)
  • For your References section:

    A long Stokes shift red fluorescent Ca(2+) indicator protein for two-photon and ratiometric imaging. Wu J, Abdelfattah AS, Miraucourt LS, Kutsarova E, Ruangkittisakul A, Zhou H, Ballanyi K, Wicks G, Drobizhev M, Rebane A, Ruthazer ES, Campbell RE. Nat Commun. 2014 Oct 31;5:5262. doi: 10.1038/ncomms6262. 10.1038/ncomms6262 PubMed 25358432