-
PurposepAAV-U6sgRNA(SapI)_hSyn-GFP-KASH-bGH (SpGuide acceptor). AAV plasmid for sgRNA cloning. GFP-KASH fusion facilitates FACS sorting of cells and nuclei.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 60958 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 2905
- Total vector size (bp) 5314
-
Vector typeMammalian Expression, Mouse Targeting, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameU6_(SpaI)_sgRNA
-
SpeciesSynthetic
-
Insert Size (bp)351
- Promoter U6
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer cgcgtgagggcctatttcc
- 3′ sequencing primer gcaagtgggttttaggaccag (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameSyn_EGFP-KASH
-
SpeciesSynthetic
-
Insert Size (bp)349
- Promoter Synapsin
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer ctgcgtatgagtgcaagtgggtt
- 3′ sequencing primer ccgttggtgtaccgcagcatg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PX552 was a gift from Feng Zhang (Addgene plasmid # 60958 ; http://n2t.net/addgene:60958 ; RRID:Addgene_60958) -
For your References section:
In vivo interrogation of gene function in the mammalian brain using CRISPR-Cas9. Swiech L, Heidenreich M, Banerjee A, Habib N, Li Y, Trombetta J, Sur M, Zhang F. Nat Biotechnol. 2014 Oct 19. doi: 10.1038/nbt.3055. 10.1038/nbt.3055 PubMed 25326897