PX551
(Plasmid #60957)

• Purpose: pAAV-pMecp2-SpCas9-spA (AAV-SpCas9). AAV plasmid expressing Cas9 in neurons under control of truncated mecp2 promoter.
• Depositing Lab: Feng Zhang
• Publication: Swiech et al Nat Biotechnol. 2014 Oct 19. doi: 10.1038/nbt.3055.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 2905
• Total vector size (bp): 7400
• Vector type: Mammalian Expression, AAV, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SpCas9
• Alt name: S. pyogenes Cas9 nuclease
• Alt name: Cas9
• Species: Synthetic
• Insert Size (bp): 4200
• Promoter: pMecp2
• Tag / Fusion Protein:
  • HA (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: AATGGGGTCCGCCTCTTTTCC
• 3′ sequencing primer: cttagctggcctccacctttctcttc

Resource Information

• Supplemental Documents:
  • PX551
• Addgene Notes:
  • Addgene Diagnostic Test
• Articles Citing this Plasmid:
  • 37 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry