miR-144 Trap
(Plasmid #60934)

• Purpose: to knockdown endogenous miR144 levels; lentiviral vector containing 8x copies of complementary miR-144-binding sites cloned 3' to GFP under the control of a biPGK promoter
• Depositing Lab: Curt Civin
• Publication: Kim et al Br J Haematol. 2014 Oct 14. doi: 10.1111/bjh.13164.

Backbone

• Vector backbone: biPGK
• Backbone manufacturer: Naldini lab. Brown, et al. 2007 PMID 18026085
• Backbone size w/o insert (bp): 9213
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: miR-144 Trap
• Alt name: 8 copies of fully complementary trap sequences against the mature miR
• Insert Size (bp): 260
• Promoter: bidirectional phosphoglycerate kinase promoter (biPGK)
• Tag / Fusion Protein:
  • GFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: biPGK-F (CTGACAATTCCGTGGTGTTGTCGG)
• 3′ sequencing primer: biPGK-R (CCCAGGCTCAGATCTGGTCTAACC)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry