AAV-FLEX-VAMP2:HRP
(Plasmid
#60659)
-
PurposeLabels synaptic vesicles for electron microscopy
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 60659 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAAV-FLEX
- Backbone size w/o insert (bp) 5020
- Total vector size (bp) 1379
-
Vector typeAAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameVAMP2:HRP
-
Alt nameSbv2:HRP
-
SpeciesB. taurus (bovine), Synthetic
- Promoter CAG
-
Tag
/ Fusion Protein
- Myc
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Spe1 (destroyed during cloning)
- 3′ cloning site Spe1 (destroyed during cloning)
- 5′ sequencing primer CTGTGGCTGCGTGAAAGCCTTG
- 3′ sequencing primer CTGACAACGGGCCACAACTC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byEge Kavalali provided the VAMP2 and the HRP cDNA
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-FLEX-VAMP2:HRP was a gift from Scott Sternson (Addgene plasmid # 60659 ; http://n2t.net/addgene:60659 ; RRID:Addgene_60659) -
For your References section:
A genetically specified connectomics approach applied to long-range feeding regulatory circuits. Atasoy D, Betley JN, Li WP, Su HH, Sertel SM, Scheffer LK, Simpson JH, Fetter RD, Sternson SM. Nat Neurosci. 2014 Dec;17(12):1830-9. doi: 10.1038/nn.3854. Epub 2014 Nov 2. 10.1038/nn.3854 PubMed 25362474
Map uploaded by the depositor.