Skip to main content
Addgene

AAV-FLEX-VAMP2:HRP
(Plasmid #60659)

Print

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 60659 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    AAV-FLEX
  • Backbone size w/o insert (bp) 5020
  • Total vector size (bp) 1379
  • Vector type
    AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    VAMP2:HRP
  • Alt name
    Sbv2:HRP
  • Species
    B. taurus (bovine), Synthetic
  • Promoter CAG
  • Tag / Fusion Protein
    • Myc

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Spe1 (destroyed during cloning)
  • 3′ cloning site Spe1 (destroyed during cloning)
  • 5′ sequencing primer CTGTGGCTGCGTGAAAGCCTTG
  • 3′ sequencing primer CTGACAACGGGCCACAACTC
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Ege Kavalali provided the VAMP2 and the HRP cDNA

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-FLEX-VAMP2:HRP was a gift from Scott Sternson (Addgene plasmid # 60659 ; http://n2t.net/addgene:60659 ; RRID:Addgene_60659)

  • For your References section:

    A genetically specified connectomics approach applied to long-range feeding regulatory circuits. Atasoy D, Betley JN, Li WP, Su HH, Sertel SM, Scheffer LK, Simpson JH, Fetter RD, Sternson SM. Nat Neurosci. 2014 Dec;17(12):1830-9. doi: 10.1038/nn.3854. Epub 2014 Nov 2. 10.1038/nn.3854 PubMed 25362474
Related items:
Commonly requested with: