AAV-FLEX-VAMP2:HRP
(Plasmid #60659)

• Purpose: Labels synaptic vesicles for electron microscopy
• Depositing Lab: Scott Sternson
• Publication: Atasoy et al Nat Neurosci. 2014 Dec;17(12):1830-9. doi: 10.1038/nn.3854. Epub 2014 Nov 2.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: AAV-FLEX
• Backbone size w/o insert (bp): 5020
• Total vector size (bp): 1379
• Vector type: AAV, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: VAMP2:HRP
• Alt name: Sbv2:HRP
• Species: B. taurus (bovine), Synthetic
• Promoter: CAG
• Tag / Fusion Protein:
  • Myc

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Spe1 (destroyed during cloning)
• 3′ cloning site: Spe1 (destroyed during cloning)
• 5′ sequencing primer: CTGTGGCTGCGTGAAAGCCTTG
• 3′ sequencing primer: CTGACAACGGGCCACAACTC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Ege Kavalali provided the VAMP2 and the HRP cDNA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry