-
PurposeYeast D-Amino acid oxidase from Rhodotorula gracilis, optimized for mammalian expression.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 60344 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepC1
- Backbone size w/o insert (bp) 3982
- Total vector size (bp) 5083
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDAAO
-
SpeciesSynthetic
-
Insert Size (bp)1101
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ggtgggaggtctatataag
- 3′ sequencing primer cctctacaaatgtggtatgg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-DAAO was a gift from Vsevolod Belousov (Addgene plasmid # 60344 ; http://n2t.net/addgene:60344 ; RRID:Addgene_60344) -
For your References section:
How much H(2)O(2) is produced by recombinant D-amino acid oxidase in mammalian cells?. Matlashov ME, Belousov VV, Enikolopov G. Antioxid Redox Signal. 2014 Mar 1;20(7):1039-44. doi: 10.1089/ars.2013.5618. Epub 2013 Oct 23. 10.1089/ars.2013.5618 PubMed 24020354