-
PurposeChemogenetic fluorescent H2O2 reporter targeted to the mitochondria
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 168304 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCS2+
- Backbone size w/o insert (bp) 4095
- Total vector size (bp) 6868
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHyPer7.2DAAO-mito
-
SpeciesSynthetic
-
Insert Size (bp)2784
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer CGCGATGGCTGCCAAGTACA
- 3′ sequencing primer TGACCATGATTACGCCAAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byPartial sequence (HyPer7.2) was a gift from Vsevolod Belousov Lab.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HyPer7.2DAAO-mito was a gift from Thomas Michel (Addgene plasmid # 168304 ; http://n2t.net/addgene:168304 ; RRID:Addgene_168304) -
For your References section:
Differential endothelial signaling responses elicited by chemogenetic H2O2 synthesis. Saeedi Saravi SS, Eroglu E, Waldeck-Weiermair M, Sorrentino A, Steinhorn B, Belousov V, Michel T. Redox Biol. 2020 Sep;36:101605. doi: 10.1016/j.redox.2020.101605. Epub 2020 Jun 16. 10.1016/j.redox.2020.101605 PubMed 32590330