pGL2 HNF4A P2 mut
(Plasmid #60325)

• Purpose: Mutated HNF4A P2 promoter region cloned into the pGL2-basic backbone. The -181 G to A mutation is in a HNF1alpha binding site and cosegregates with MODY.
• Depositing Lab: Jorge Ferrer
• Publication: Hansen et al J Clin Invest. 2002 Sep;110(6):827-33.

Backbone

• Vector backbone: pGL2-basic
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 5598
• Vector type: Mammalian Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: HNF4A P2 mut (-181 G to A)
• Species: H. sapiens (human)
• Mutation: The -181 G to A mutation is in a HNF1alpha binding site and cosegregates with MODY.
• Entrez Gene: HNF4A (a.k.a. FRTS4, HNF4, HNF4a7, HNF4a8, HNF4a9, HNF4alpha, MODY, MODY1, NR2A1, NR2A21, TCF, TCF-14, TCF14)
• Tag / Fusion Protein:
  • Luciferase (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Unknown (not destroyed)
• 3′ cloning site: Unknown (not destroyed)
• 5′ sequencing primer: GLprimer2 (Promega): CTTTATGTTTTTGGCGTCTTCCA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

–371 to –37 from HNF4A TSS