Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCAP01
(Plasmid #59981)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 59981 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    SuperCos1
  • Backbone manufacturer
    Agilent
  • Backbone size (bp) 7600
  • Modifications to backbone
    The RP4 origin and attP site was inserted into the vector for heterologous expressing biosynthetic gene cluster in actinobacteria. The vector also contains the TRP1 gene and CEN6_ARS4 for selecting in S. cerevisiae tryptophan deficient mutant.
  • Vector type
    Bacterial Expression, Yeast Expression, Synthetic Biology ; transformation-associated recombination cloning
  • Promoter no
  • Selectable markers
    TRP1, URA3
  • Tag / Fusion Protein
    • no

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TATGTCCTGCGGGTAAATAG
  • 3′ sequencing primer TCGGGGAAATGTGCGCGGAA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAP01 was a gift from Bradley Moore (Addgene plasmid # 59981 ; http://n2t.net/addgene:59981 ; RRID:Addgene_59981)
  • For your References section:

    Direct cloning and refactoring of a silent lipopeptide biosynthetic gene cluster yields the antibiotic taromycin A. Yamanaka K, Reynolds KA, Kersten RD, Ryan KS, Gonzalez DJ, Nizet V, Dorrestein PC, Moore BS. Proc Natl Acad Sci U S A. 2014 Feb 4;111(5):1957-62. doi: 10.1073/pnas.1319584111. Epub 2014 Jan 21. 10.1073/pnas.1319584111 PubMed 24449899