Skip to main content
Addgene

pCAG_mRuby2_smFP OLLAS
(Plasmid #59761)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 59761 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCAG
  • Backbone size w/o insert (bp) 5000
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mRuby2_smFP_OLLAS
  • Species
    Synthetic
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (unknown if destroyed)
  • 3′ cloning site AgeI (unknown if destroyed)
  • 5′ sequencing primer GGTTCGGCTTCTGGCGTGTGACC
  • 3′ sequencing primer ttaaagcagcgtatccacat
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG_mRuby2_smFP OLLAS was a gift from Loren Looger (Addgene plasmid # 59761 ; http://n2t.net/addgene:59761 ; RRID:Addgene_59761)

  • For your References section:

    High-performance probes for light and electron microscopy. Viswanathan S, Williams ME, Bloss EB, Stasevich TJ, Speer CM, Nern A, Pfeiffer BD, Hooks BM, Li WP, English BP, Tian T, Henry GL, Macklin JJ, Patel R, Gerfen CR, Zhuang X, Wang Y, Rubin GM, Looger LL. Nat Methods. 2015 Jun;12(6):568-76. doi: 10.1038/nmeth.3365. Epub 2015 Apr 27. 10.1038/nmeth.3365 PubMed 25915120
Related items:
Commonly requested with: