Skip to main content
Addgene

p221- purVSG117UTR
(Plasmid #59732)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 59732 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBluescriptII
  • Backbone size w/o insert (bp) 3045
  • Total vector size (bp) 8476
  • Vector type
    For homologous recombination into VSG221 expression site in T. brucei
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    VSG117 flanked upstream and downstream by sequences homologous to the VSG221 expression site
  • Species
    T. brucei Lister 427
  • Insert Size (bp)
    5431

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer aacaaaagctggagctccac
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p221- purVSG117UTR was a gift from Gloria Rudenko (Addgene plasmid # 59732 ; http://n2t.net/addgene:59732 ; RRID:Addgene_59732)
  • For your References section:

    Blocking variant surface glycoprotein synthesis in Trypanosoma brucei triggers a general arrest in translation initiation. Smith TK, Vasileva N, Gluenz E, Terry S, Portman N, Kramer S, Carrington M, Michaeli S, Gull K, Rudenko G. PLoS One. 2009 Oct 26;4(10):e7532. doi: 10.1371/journal.pone.0007532. 10.1371/journal.pone.0007532 PubMed 19855834