pQCXIN-TetR-mCherry
(Plasmid #59417)

• Purpose: retroviral construct expressing the Tet repressor (TetR) tagged with mCherry
• Depositing Lab: Tom Misteli
• Publication: Roukos et al Science. 2013 Aug 9;341(6146):660-4. doi: 10.1126/science.1237150.

Backbone

• Vector backbone: pQCXIN
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 7400
• Total vector size (bp): 8738
• Vector type: Retroviral
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Tet repressor protein (TetR)
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (unknown if destroyed)
• 3′ cloning site: EcoRI (unknown if destroyed)
• 5′ sequencing primer: ACGCCATCCACGCTGTTTTGACCT
• 3′ sequencing primer: AAGCGGCTTCGGCCAGTAACGTTA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The AgeI-EcoRI fragment from TetRmCherry (a gift from Dr E. Heard, see Masui et al Cell. 2011 Apr 29;145(3):447-58)was cloned to pQCIN vector by Christine Schmidt
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry