Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Lac-I-SceI-Tet
(Plasmid #17655)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 17655 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBluescript
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 3000
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    30 degrees, Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    lac I-SceI tet
  • Alt name
    lac operator
  • Alt name
    tet operator

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The 256 lac operator repeats (XhoI fragment) and the 96 tet operator repeats (XhoI –SacII fragment) from the p16PCbeta
plasmid (gift from D. Spector) were cloned into pBluescript. Between the two fragments a single 18nt I-SceI site was inserted (SalI).

lac operator repeat: tggaattgtgagcggataacaatt
tet operator repeat: tccctatcagtgatagaga

This plasmid is not stable in bacteria. Every bacterial stock made will contain correct and incorrect bacteria and when bacteria are grown, you will get colonies which contain the correct plasmid and others which contain recombinant versions. If you check multiple colonies (10-20) in the samples after streaking out a stab, you should find correct ones. The recipient will need to grow the bacteria, isolate individual colonies check them, and make a prep from the correct one. We recommend processing the stab and screening colonies immediately upon receipt.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lac-I-SceI-Tet was a gift from Tom Misteli (Addgene plasmid # 17655 ; http://n2t.net/addgene:17655 ; RRID:Addgene_17655)
  • For your References section:

    Positional stability of single double-strand breaks in mammalian cells. Soutoglou E, Dorn JF, Sengupta K, Jasin M, Nussenzweig A, Ried T, Danuser G, Misteli T. Nat Cell Biol. 2007 Jun . 9(6):675-82. 10.1038/ncb1591 PubMed 17486118